Nucleotide Sequencing Results - CULTURE # 6
Culture #6 - Set A
|
aagcttaattatcaataatgaactaggtaacatactgtccataaaagtacacttcaagaaaaatagtgcacttagacgtaagaagtttacttgga |
Questions for students include:
What is the name of the organism type from which this nucleotide sequence was taken?
What feature of the organism type is represented, i.e., what does this sequence code for?
List taxonomic information, i.e., lineage for the organisms (cut and paste from NCBI).
Find the article that provided the reference sequence, and answer the following questions.
1. Catabolite repression in these organisms involves a catabolite control protein A (CcpA) which interacts with __________________________________________________________ to effect catabolite repression by a negative control mechanism.
2. What is the product of the newly identified gene glcP, and what is the function of this protein?
3. The mutant bacteria presented in this paper did not display glucose mediated catabolite repression, but they exhibited strong repression in response to what? (See discussion section.)
Culture #6 - Set B
|
atgatgaaaaaatcgatatgctgcgcactgctgctgacagcctctttctccacgtttgctgccgcaaaaacagaacaacaaattgccgatatcgttaa |
Questions for students include:
What is the name of the organism type from which this nucleotide sequence was taken?
What feature of the organism type is represented, i.e., what does this sequence code for?
List taxonomic information, i.e., lineage for the organisms (cut and paste from NCBI).
Find the article that provided the reference sequence, and answer the following questions.
1. Which antibiotics are the most widely used currently (accounting for 50% of the antibiotics used globally)?
2. The Amp-C b-lactamases are primarily _________________ that mediate resistance to what?
Copyright 2003 Sierra College Biological Sciences Department
Last updated: 10/29/03.
