Nucleotide Sequencing Results - CULTURE # 5
Culture #5 - Set A
|
ctatttggggtgagtagataattgagccgcttttcaaactttttaatggtgaaaaaataatccatctcactcttgatgaagtaagacggattatt |
Questions for students include:
What is the name of the organism type from which this nucleotide sequence was taken?
What feature of the organism type is represented, i.e., what does this sequence code for?
List taxonomic information, i.e., lineage for the organisms (cut and paste from NCBI).
Find the article that provided the reference sequence, and answer the following questions.
1. When was the lactose operon of E. coli discovered?
2. Where is the b-galactosidase gene of this bacteria located relative to the permease gene?
3. Cultures of this bacteria do not usually ferment galactose. Is this because they lack genes coding for enzymes that would allow galactose utilization to occur, or is it because these genes are not being induced?
Culture #5 - Set B
|
aagcttttgtgagccgtcgaagtgctcatgacaaggcgaagccgcagtcggggtgtatctccgcgttagcgagccgtaagggctgcttac |
Questions for students include:
What is the name of the organism type from which this nucleotide sequence was taken?
What feature of the organism type is represented, i.e., what does this sequence code for?
List taxonomic information, i.e., lineage for the organisms (cut and paste from NCBI).
Find the article that provided the reference sequence, and answer the following questions.
1. How have Gram-negative bacteria responded to the clinical use of extended-spectrum cephalosporins?
2. Overproduction or constitutive production of inducible chromosomal b-lactamase causes what in these bacteria?
3. These bacteria are known to gain resistance to b-lactams easily because of mutations in what?
Copyright 2003 Sierra College Biological Sciences Department
Last updated: 10/29/03.
