Nucleotide Sequencing Results - CULTURE # 25
Culture #25 - Set A
|
acaatatcagatatgaaacataaagtgttaggagcacaatcagcttcatcaggttatgactccttgttaagaactcctaaactgctgaaaga |
Questions for students include:
What is the name of the organism type from which this nucleotide sequence was taken?
What feature of the organism type is represented, i.e., what does this sequence code for?
List taxonomic information, i.e., lineage for the organisms (cut and paste from NCBI).
Find the article that provided the reference sequence and answer the following questions.
1. What is the CAMP reaction?
2. What is the name of the bacteria that produce sphingomyalinase C (beta toxin)?
Culture #25 - Set B
|
ttgtgaatcagcaaaacgccgggttattcttatttgtcgcttctttactcgcctttatcggccctcactcaaggatgtattgtggttatgcgtta |
Questions for students include:
What is the name of the organism type from which this nucleotide sequence was taken?
What feature of the organism type is represented, i.e., what does this sequence code for?
List taxonomic information, i.e., lineage for the organisms (cut and paste from NCBI).
Find the article that provided the reference sequence, and answer the following questions.
1. What are ESBLs and what is their significance?
2. The bacteria that carry genes coding for ESBLs are frequently associated with what types of infections?
Copyright 2003 Sierra College Biological Sciences Department
Last updated: 10/29/03.
