Nucleotide Sequencing Results - CULTURE # 23
Culture #23 - Set A
|
aaattcttctttttatgcaaccgcttgctctatactatttttgtagacgtttacaaaatgttgtcgaattagactatgcttttggggaggatgatcg |
Questions for students include:
What is the name of the organism type from which this nucleotide sequence was taken?
What feature of the organism type is represented, i.e., what does this sequence code for?
List taxonomic information, i.e., lineage for the organisms (cut and paste from NCBI).
Find the article that provided the reference sequence, and answer the following questions.
1. The gene coding for beta amylase was cloned in what type of bacteria?
2. Does the sequence shown contain a translational stop codon? If not; why not?
3. What type of sequence occurs immediately upstream of the signal sequence indicated by italics (coding for 38 amino acids)?
Culture #23 - Set B
|
atgatgaaaaaatcgatatgctgcgcactgctgctgacagcctctttctccacgtttgctgccgcaaaaacagaacaacaaattgccg |
Questions for students include:
What is the name of the organism type from which this nucleotide sequence was taken?
What feature of the organism type is represented, i.e., what does this sequence code for?
List taxonomic information, i.e., lineage for the organisms (cut and paste from NCBI).
Find the article that provided the reference sequence, and answer the following questions.
1. Which antibiotics are the most widely used currently (accounting for 50% of the antibiotics used globally)?
2. The Amp-C b-lactamases are primarily _________________ that mediate resistance to what?
Copyright 2003 Sierra College Biological Sciences Department
Last updated: 10/29/03.
