Nucleotide Sequencing Results - CULTURE # 19
Culture #19 - Set A
|
aagcttgtgattgcaatgaatcacatttaatatctaattcaaagaatgaatgattagaagaggagatgtttatttagcggatttatcaccagttca |
Questions for students include:
What is the name of the organism type from which this nucleotide sequence was taken?
What feature of the organism type is represented, i.e., what does this sequence code for?
List taxonomic information, i.e., lineage for the organisms (cut and paste from NCBI).
Find the article that provided the reference sequence, and answer the following questions.
1. These bacteria are normal inhabitants of human skin and mucous membranes and are the predominant cause of what?
2. Synthesis of the polysaccharide intercellular adhesin (PIA) is essential for bacterial cell accumulation because…?
3. Understanding for the regulatory mechanisms regulating PIA synthesis and biofilm formation is of primary importance for what?
Culture #19 - Set B
|
ttgtgaaaggtaaacgttcattacatgtgtgtaatgccccatcacctgctgcaacagcgtctattgagataggacgagaaatagtaaaagagcattt |
Questions for students include:
What is the name of the organism type from which this nucleotide sequence was taken?
What feature of the organism type is represented, i.e., what does this sequence code for?
List taxonomic information, i.e., lineage for the organisms (cut and paste from NCBI).
Find the article that provided the reference sequence, and answer the following questions.
1. The organisms featured in this article were previously identified as what? (Note - The previous name applies to your unknown).
2. These organisms are naturally resistant to what?
3. According to the French Society for Microbiology (see case report), the pattern of synergy observed with the antimicrobial susceptibility testing was due to what?
Copyright 2003 Sierra College Biological Sciences Department
Last updated: 10/29/03.
