Nucleotide Sequencing Results - CULTURE # 18
Culture #18 - Set A
|
ctatttggggtgagtagataattgagccgcttttcaaactttttaatggtgaaaaaataatccatctcactcttgatgaagtaagacggatt |
Questions for students include:
What is the name of the organism type from which this nucleotide sequence was taken?
What feature of the organism type is represented, i.e., what does this sequence code for?
List taxonomic information, i.e., lineage for the organisms (cut and paste from NCBI).
Find the article that provided the reference sequence, and answer the following questions.
1. When was the lactose operon of E. coli discovered?
2. Where is the b-galactosidase gene of this bacteria located relative to the permease gene?
3. Cultures of this bacteria do not usually ferment galactose. Is this because they lack genes coding for enzymes that would allow galactose utilization to occur, or is it because these genes are not being induced?
Culture #18 - Set B
|
ccaggatcctggcgagacactataagcaggcgctggaaggacaaatatcgaattgatgatggaattccatcatcaataaattgcttgtca |
Questions for students include:
What is the name of the organism type from which this nucleotide sequence was taken?
What feature of the organism type is represented, i.e., what does this sequence code for?
List taxonomic information, i.e., lineage for the organisms (cut and paste from NCBI).
Find the article that provided the reference sequence, and answer the following questions.
1. Since the early 1980s these bacteria have been recognized as what?
2. In wild type strains of these bacteria, chromosomal b-lactamases are constitutively produced at low levels and affect the organisms susceptibility to ___________________ while overproduction confers resistance to what?
Copyright 2003 Sierra College Biological Sciences Department
Last updated: 10/29/03.
