Nucleotide Sequencing Results - CULTURE # 17
Culture #17 - Set A
|
atgaaaaaaacagcatttacattacttttattcattgccctaacgttgacaacaagtccacttgtaaatggtagcgagaaaagcgaagaaa |
Questions for students include:
What is the name of the organism type from which this nucleotide sequence was taken?
What feature of the organism type is represented, i.e., what does this sequence code for?
List taxonomic information, i.e., lineage for the organisms (cut and paste from NCBI).
Find the article that provided the reference sequence, and answer the following questions.
Note - Students must access the full-text article from Lancet to answer the questions.
1. Describe the BLA Operon (name the genes present, what they code for, and what functions are associated with the proteins coded for).
2. How do leukocidins kill phagocytic WBCs?
3. What are superantigens?
Culture #17 - Set B
|
atgatgaaaaaatcgatatgctgcgcactgctgctgacagcctctttctccacgtttgctgccgcaaaaacagaacaacaaattgccgatatcgtta |
Questions for students include:
What is the name of the organism type from which this nucleotide sequence was taken?
What feature of the organism type is represented, i.e., what does this sequence code for?
List taxonomic information, i.e., lineage for the organisms (cut and paste from NCBI).
Find the article that provided the reference sequence, and answer the following questions.
1. Which antibiotics are the most widely used currently (accounting for 50% of the antibiotics used globally)?
2. The Amp-C b-lactamases are primarily _________________ that mediate resistance to what?
Copyright 2003 Sierra College Biological Sciences Department
Last updated: 10/29/03.
