Nucleotide Sequencing Results - CULTURE # 16
Culture #16 - Set A
|
ggaagcatcagcttagcaatcccgcataccctgtctggcacctaccagatcttgtagttgagccggtacgagcgttctgtgttttatgca |
Questions for students include:
What is the name of the organism type from which this nucleotide sequence was taken?
What feature of the organism type is represented, i.e., what does this sequence code for?
List taxonomic information, i.e., lineage for the organisms (cut and paste from NCBI).
Include abstract from NATURE (Medical significance of the organism being investigated)
Find the article that provided the reference sequence and answer the following questions.
1. What is pyocyanin?
2. What are the pathophysiological effects of pyocyanin in human airways?
3. What effect do the phenazines produced by these organisms have on alveolar macrophages?
Culture #16 - Set B
|
aagcttttgtgagccgtcgaagtgctcatgacaaggcgaagccgcagtcggggtgtatctccgcgttagcgagccgtaagggctgcttacgg |
Questions for students include:
What is the name of the organism type from which this nucleotide sequence was taken?
What feature of the organism type is represented, i.e., what does this sequence code for?
List taxonomic information, i.e., lineage for the organisms (cut and paste from NCBI).
Find the article that provided the reference sequence, and answer the following questions.
1. How have Gram-negative bacteria responded to the clinical use of extended-spectrum cephalosporins?
2. Overproduction or constitutive production of inducible chromosomal b-lactamase causes what in these bacteria?
3. These bacteria are known to gain resistance to b-lactams easily because of mutations in what?
Copyright 2003 Sierra College Biological Sciences Department
Last updated: 10/29/03.
