Nucleotide Sequencing Results - CULTURE # 15
Culture #15 - Set A
|
tggagatacggctctttctgcaaatgaagcgagaatgaaagagaccttgcaaaaggctggattatttgcaaaatctatgaatgcctattcttat |
Questions for students include:
What is the name of the organism type from which this nucleotide sequence was taken?
What feature of the organism type is represented, i.e., what does this sequence code for?
List taxonomic information, i.e., lineage for the organisms (cut and paste from NCBI).
Find the article that provided the reference sequence, and answer the following questions.
1. What four species belong within this group of bacteria?
2. Which newly described species is psychroduric?
3. What symptoms are associated with the emetic toxin and enterotoxins produced by these bacteria?
Culture #15 - Set B
|
ttgtgaatcagcaaaacgccgggttattcttatttgtcgcttctttactcgcctttatcggccctcactcaaggatgtattgtggttatgcgttatttt |
Questions for students include:
What is the name of the organism type from which this nucleotide sequence was taken?
What feature of the organism type is represented, i.e., what does this sequence code for?
List taxonomic information, i.e., lineage for the organisms (cut and paste from NCBI).
Find the article that provided the reference sequence, and answer the following questions.
1. What are ESBLs and what is their significance?
2. The bacteria that carry genes coding for ESBLs are frequently associated with what types of infections?
Copyright 2003 Sierra College Biological Sciences Department
Last updated: 10/29/03.
