Nucleotide Sequencing Results - CULTURE # 14
Culture #14 - Set A
|
ggaagcatcagcttagcaatcccgcataccctgtctggcacctaccagatcttgtagttgagccggtacgagcgttctgtgttttatgcaatccaca |
Questions for students include:
What is the name of the organism type from which this nucleotide sequence was taken?
What feature of the organism type is represented, i.e., what does this sequence code for?
List taxonomic information, i.e., lineage for the organisms (cut and paste from NCBI).
Include abstract from NATURE (Medical significance of the organism being investigated)
Find the article that provided the reference sequence and answer the following questions.
1. What is pyocyanin?
2. What are the pathophysiological effects of pyocyanin in human airways?
3. What effect do the phenazines produced by these organisms have on alveolar macrophages?
Culture #14 - Set B
|
atggcacaagtcattaataccaacagcctctcgctgatcactcaaaataatatcaacaagaaccagtctgcgctgtcgagttctatcgagcgtct |
Questions for students include:
What is the name of the organism type from which this nucleotide sequence was taken?
What feature of the organism type is represented, i.e., what does this sequence code for?
List taxonomic information, i.e., lineage for the organisms (cut and paste from NCBI).
Find the article that provided the reference sequence, and answer the following questions.
1. What do genes located at the fliC locus code for in the subject bacteria?
2. Which antigens are most frequently used to identify different strains of these bacteria?
3. What type of disease is caused by these bacteria in the strain O157:H7 and how were these organisms transmitted to 477 U.S. residents in 1993?
Copyright 2003 Sierra College Biological Sciences Department
Last updated: 10/29/03.
