Nucleotide Sequencing Results - CULTURE # 10
Culture #10 - Set A
|
atgaaaaaatttatacttcctatattcagcatttctattctagtttctctcagtgcatgttcatctattaaaactaaatctgaagataattttcatatttctt |
Questions for students include:
What is the name of the organism type from which this nucleotide sequence was taken?
What feature of the organism type is represented, i.e., what does this sequence code for?
List taxonomic information, i.e., lineage for the organisms (cut and paste from NCBI).
Find the article that provided the reference sequence, and answer the following questions.
1. What types of diseases are caused by these bacteria?
2. What antimicrobial agents have recently become the drugs of choice for controlling these bacteria, and what has occurred to present a problem with this practice?
3. The bacteria that served as the subject of this research paper came from what source?
Culture #10 - Set B
|
gtcgacttcatcctgataaaacacaggatgtgcagtctgctcctgagccagcgcctgatcaatgacaagccgtttttcttcatagtgcggatctttga |
Questions for students include:
What is the name of the organism type from which this nucleotide sequence was taken?
What feature of the organism type is represented, i.e., what does this sequence code for?
List taxonomic information, i.e., lineage for the organisms (cut and paste from NCBI).
Find the article that provided the reference sequence, and answer the following questions.
1. What size is the virulence plasmid in S. enterica serovar Typhimurium?
2. What structures do genes on the pef operon code for?
3. The complete DNA sequence of this plasmid could provide what?
Copyright 2003 Sierra College Biological Sciences Department
Last updated: 10/29/03.
