Nucleotide Sequencing Results - CULTURE # 1
Culture #1 - Set A
|
aagcttgtgattgcaatgaatcacatttaatatctaattcaaagaatgaatgattagaagaggagatgtttatttagcggatttatcaccagttcaa |
Questions for students include:
What is the name of the organism type from which this nucleotide sequence was taken?
What feature of the organism type is represented, i.e., what does this sequence code for?
List taxonomic information, i.e., lineage for the organisms (cut and paste from NCBI).
Find the article that provided the reference sequence, and answer the following questions.
1. These bacteria are normal inhabitants of human skin and mucous membranes and are the predominant cause of what?
2. Synthesis of the polysaccharide intercellular adhesin (PIA) is essential for bacterial cell accumulation because…?
3. Understanding for the regulatory mechanisms regulating PIA synthesis and biofilm formation is of primary importance for what?
Culture #1 - Set B
|
ccgcgaacgcgtgcgtcagattcaggttgaaggtctgcgccgtctgcgggaaatcctgcagggtcaggggcttaacatcgaagcgctgttccgt |
Questions for students include:
What is the name of the organism type from which this nucleotide sequence was taken?
What feature of the organism type is represented, i.e., what does this sequence code for?
List taxonomic information, i.e., lineage for the organisms (cut and paste from NCBI).
Find the article that provided the reference sequence, and answer the following questions.
1. The nucleotide sequence located downstream from the rpoS gene in Enterobacter cloacae and Kluyvera cryocrescens contains what genes?
2. What is the size of the insert sequence described in this article?
3. This article suggests that the insert being studied may be related to pathogenesis and what else?
Copyright 2003 Sierra College Biological Sciences Department
Last updated: 10/29/03.
