Nucleotide Sequencing Results - CULTURE # 13
Culture #13 - Set A
|
gaattccgcctttctttgctttttgattattatacaaaaaaaaagacggtgttcaaaagaaaaactcatgaaaaaacgcctcagctttcact |
Questions for students include:
What is the name of the organism type from which this nucleotide sequence was taken?
What feature of the organism type is represented, i.e., what does this sequence code for?
List taxonomic information, i.e., lineage for the organisms (cut and paste from NCBI).
Find the article that provided the reference sequence, and answer the following questions.
1. What is carbamate kinase and what does it do?
2. The gene for this enzyme in this bacteria is identical in nucleotide sequence to a gene from what other type of bacteria?
3. What other enzyme has been found to have a similar structure and perhaps share a common catalytic mechanism with this one?
Culture #13 - Set B
|
gcgaaaaattaattgttatctctttttttatctacttataaattgacctttttcctaaaaagcaaagcccaaaattggcgatgatatatggcgttat |
Questions for students include:
What is the name of the organism type from which this nucleotide sequence was taken?
What feature of the organism type is represented, i.e., what does this sequence code for?
List taxonomic information, i.e., lineage for the organisms (cut and paste from NCBI).
Find the article that provided the reference sequence, and answer the following questions.
1. How is swarming characterized in these bacteria?
2. What is the function of the flagellar master operon flhDC?
Copyright 2003 Sierra College Biological Sciences Department
Last updated: 10/29/03.
